Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Supplier:  Thermo Scientific™ SO118

Catalog No. FERSO118


missing translation for 'QuantityLeft'
Explore all special offers
Add to Cart

Description

Description

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'

Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

Specifications

Specifications

SP6, T3, T7
T7 promoter Sequencing Primer, 20-mer, 10 μM

Store at –20°C.
10 μM
pTZ19R, pTZ57R, pBluescript II
Liquid
Sequencing Primer
Dry Ice
T7
Sequencing
Product Suggestions

Product Suggestions

Videos
SDS
Documents

Documents

Product Certifications
Promotions

Promotions

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Your feedback has been submitted: Thank you for helping us improve our website.

For Research Use Only. Not for use in diagnostic procedures.